Zmień kryteria/Wyszukiwanie zaawansowane
Nazwa Miasto Data
publikacji

ZAPYTANIE OFERTOWE nr 5/2017/KUŹNIA -

Przetarg publiczny. Źródło - strony WWW. INSTYTUT SZKOLEŃ I DORADZTWA MAGDALENA MROZEK.
2. Przedmiotem zamówienia jest organizacja i przeprowadzenie: a) egzaminów kwalifikacyjnych na uprawnienia spawacza MAG dla 30 uczestników projektu (3 grupy x 10 osób), którzy ukończyli kurs spawania blach i rur spoinami pachwinowymi metodą MAG 135, w wymiarze 145 godzin (25 godzin zajęć...
Bydgoszcz,
łódzkie
18-12-2017

ZAPYTANIE OFERTOWE NR 44/2017 z dnia 11.12.2017 r. W SPRAWIE ZAMÓWIENIA NA Dostawę mikroskopu...

Przetarg publiczny. Źródło - strony WWW. WAGRAN SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ.
Specyfikacja techniczna: Przedmiotem zamówienia jest zakup urządzeń pomiarowych typu mikroskop metalograficzny odwrócony wraz z dostawą, montażem, szkoleniem dla pracowników o następujących parametrach: - głowica trinokularowa z trzecim torem wizyjnym do łącznika kamery, - okulary szerokopolowe...
Łódź,
łódzkie
18-12-2017

ZAPYTANIE OFERTOWE NR 43/2017 z dnia 11.08.12.2017 r. W SPRAWIE ZAMÓWIENIA NA Dostawę kamery...

Przetarg publiczny. Źródło - strony WWW. WAGRAN SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ.
Specyfikacja techniczna: Przedmiotem zamówienia jest zakup urządzeń pomiarowych typu kamera termowizyjna z obiektywem wraz z dostawą, montażem, szkoleniem dla pracowników oraz z pełnym licencjonowanym oprogramowaniem o następujących parametrach: Rozdzielczość detektora minimum: 320x240 (768000...
Łódź,
łódzkie
18-12-2017

ZAPYTANIE OFERTOWE NR 42/2017 z dnia 11.12.2017 r. W SPRAWIE ZAMÓWIENIA NA Dostawę zestawu...

Przetarg publiczny. Źródło - strony WWW. WAGRAN SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ.
Specyfikacja techniczna- zgodnie z treścią zapytania 42/2017 stanowiącą załącznik Przedmiotem zamówienia jest dostawa zestawu szlifierek do obróbki stali szlachetnych: 1. Szlifierka kątowa inox o następujących parametrach: 1.1 średnica tarczy szlifierskiej 125 mm, 1.2 gwint wrzeciona M 14, 1.3 duże...
Łódź,
łódzkie
18-12-2017

Zakup oprogramowania umożliwiającego zintegrowanie zarządzanie przedsiębiorstwem

Przetarg publiczny. Źródło - strony WWW. BUD- TRANS ROBOTY BUDOWLANO- DROGOWE MARIA KARBOWIAK.
Zakup oprogramowania charakteryzującego się elastyczną budową modułową, umożliwiającego zintegrowanie zarządzanie przedsiębiorstwem w obszarach: A. Księgowość, środki trwałe B. handel i sprzedaż C. kadry i płace D. analizy Wszystkie moduły wdrożone w wyniku realizacji projektu powinny być ze sobą...
Sieradz,
łódzkie
18-12-2017

Zapytanie ofertowe nr 8/CNA/2017 - PRZEPROWADZENIE SZKOLENIA ZAWODOWEGO DLA UCZESTNIKÓW PROJEKTU...

Przetarg publiczny. Źródło - strony WWW. FOCUS TRAINING. INSTYTUT DOSKONALENIA KADR I ROZWOJU OSOBOWOŚCI KRÓLEWICZ MARZANNA.
Szczegółowy opis zawiera załącznik nr 1 - zapytanie ofertowe 8/CNA/2017 Przedmiotem zamówienia jest PRZEPROWADZENIE SZKOLENIA ZAWODOWEGO DLA UCZESTNIKÓW PROJEKTU „Czas na aktywność!” (RPLD-09.01.01-10-B055/17) 1) PRACOWNIK GOSPODARCZY dla 4 uczestników projektu (min. 80 godzin szkoleniowych), w...
Sulnowo,
łódzkie
18-12-2017

ZAPYTANIE OFERTOWE nr 19/2017 dot. zakupu czterokanałowego cyfrowego miernika poziomu drgań i...

Przetarg publiczny. Źródło - strony WWW. LAB-TECH RADOMSKO SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ.
Fabrycznie nowy czterokanałowy cyfrowy miernik poziomu drgań i dźwięku – 1 szt. Minimalne wymagania : 1. zakres częstotliwości pomiaru hałasu , drgań i sił od 0,5 Hz lub 10 Hz ( zależnie od mikrofonu lub czujnika) do 20 kHz 2. częstotliwość próbkowania 48kHz 3. zakres czułości od 15dBA do 140dBA...
Radomsko,
łódzkie
18-12-2017

Dostawa odczynników do celów naukowo badawczych projektu Farm@Bio. Nazwa produktu: DFS-Taq DNA...

Przetarg publiczny. Źródło - strony WWW. UNIWERSYTET MEDYCZNY W ŁODZI.
Dostawa odczynnika do celów naukowo badawczych projektu Farm@Bio. Nazwa odczynnika: DFS-Taq DNA polymerase 500U, ilość: 10 szt. Dokładny opis przedmiotu zamówienia: DFS-Taq DNA Polymerase, wielkość ok. 94 kDa, wyizolowany z eubakterii Thermus aquaticus szczep YT-1(1), enzym niemodyfikowany,...
Łódź,
łódzkie
18-12-2017

Dostawa odczynników laboratoryjnych do celów naukowo badawczych projektu Farm@Bio. Nazwa produktu:...

Przetarg publiczny. Źródło - strony WWW. UNIWERSYTET MEDYCZNY W ŁODZI.
Dostawa odczynnika do celów naukowo badawczych projektu Farm@Bio. Nazwa odczynnika: oligonukleotydy: F_ok_5'CACCTGCTGTGTTTGCTCATTTAC3' - ilość: 1 szt.; F_ok_5'GGATCCTCCAAATCCAAACGTG3' - ilość: 1 szt.; F_rs17537350_5'GTGCCAAATGGGTTTCATGTTA3' - ilość: 1 szt.; R_rs17537350_5'GCAGTGCTCACCTCTGATTG3'-...
Łódź,
łódzkie
18-12-2017

Dostawa odczynników laboratoryjnych do celów naukowo badawczych projektu Farm@Bio. Nazwa produktu:...

Przetarg publiczny. Źródło - strony WWW. UNIWERSYTET MEDYCZNY W ŁODZI.
Dostawa odczynnika do celów naukowo badawczych projektu Farm@Bio. Nazwa odczynnika: GTPase-Glo Assay, ilość: 1 szt. Dokładny opis przedmiotu zamówienia: skład rGTP DTT, GTPase/GAP Buffer, GEF Buffer, GTPase-Glo™ Buffer, GTPase-Glo™ Reagent, Detection Reagent, ADP, 1000 oznaczeń
Łódź,
łódzkie
18-12-2017

Dostawa odczynników laboratoryjnych do celów naukowo badawczych projektu Farm@Bio. Nazwa produktu:...

Przetarg publiczny. Źródło - strony WWW. UNIWERSYTET MEDYCZNY W ŁODZI.
Dostawa odczynnika do celów naukowo badawczych projektu Farm@Bio. Nazwa odczynnika: MgCl2, ilość: 1 szt. Dokładny opis przedmiotu zamówienia: 1M roztwór MgCl2 w 1 opakowaniu o objętości 100ml, ilośc 1 szt. Produkt do biologii molekularnej, RNase-free, gotowy do użycia, certyfikowany i testowany...
Łódź,
łódzkie
18-12-2017

Postępowanie nr 20/2017

Przetarg publiczny. Źródło - strony WWW. FABRYKA SAMOCHODÓW OSOBOWYCH SYRENA W KUTNIE SPÓŁKA AKCYJNA.
Przedmiotem zamówienia jest zakup trzech stanowisk komputerowych do modelowania CAD 3D. Dwa stanowiska w formie stacjonarnej, jedno stanowisko mobilne (dostarczone komputery muszą być certyfikowane dla oprogramowania CAD). Zakup realizowany będzie przy pomocy leasingu. Umowa licencyjna na...
Kutno,
łódzkie
17-12-2017

Wyposażenie produkcyjne

Przetarg publiczny. Źródło - strony WWW. DEANTE ANTCZAK SPÓŁKA JAWNA.
1)drukarka termotransferowa z możliwością wydruku etykiet o szerokości do 104 mm wraz z nawijarką etykiet, sieciowa (Ethernet) 2) znakowarka laserowa do znakowania metali (powłoki CrNi na mosiądzu, stal nierdzenwa) o moc: min. 30W o maksymalna prędkość znakowania: minimum 5m/s o wielkość plamki:...
Łódź,
łódzkie
17-12-2017

Dostawa materiałów, akcesoriów laboratoryjnych oraz drobnego sprzętu laboratoryjnego nr 13/2017

Przetarg publiczny. Źródło - strony WWW. HODOWLA ROŚLIN STRZELCE SP. Z O.O. GRUPA IHAR.
Przedmiotem zamówienia jest dostawa materiałów i akcesoriów laboratoryjnych oraz drobnego sprzętu laboratoryjnego według specyfikacji zawartej w Zapytaniu ofertowym (załącznik nr 1).
Strzelce (wieś),
łódzkie
15-12-2017

Zakup pipetorów - 272017D

Przetarg publiczny. Źródło - strony WWW. PROTEON PHARMACEUTICALS S.A..
Przedmiotem zamówienia jest zakup produktów o poniższej specyfikacji: a) 2 sztuki pipetorów automatycznych o następującej specyfikacji: • bezprzewodowy z wbudowanym akumulatorem, • z ekologiczną baterią NiMH (bez kadmu) zapewniająca do 50 godzin ciągłej pracy, • przeznaczony do pracy z pipetami...
Łódź,
łódzkie
15-12-2017

Zakup pipetorów - 582017A

Przetarg publiczny. Źródło - strony WWW. PROTEON PHARMACEUTICALS S.A..
Przedmiotem zamówienia jest zakup produktów o poniższej specyfikacji: a) 4 sztuki pipetorów automatycznych o następującej specyfikacji: • bezprzewodowy z wbudowanym akumulatorem, • z ekologiczną baterią NiMH (bez kadmu) zapewniająca do 50 godzin ciągłej pracy, • przeznaczony do pracy z pipetami...
Łódź,
łódzkie
15-12-2017

ZAPYTANIE OFERTOWE – wyposażenie pracowni szkolnych/pomoce dydaktyczne – przedmioty przyrodnicze

Przetarg publiczny. Źródło - strony WWW. GMINA MIASTO OZORKÓW.
Przedmiotem niniejszego zamówienia jest zakup i dostawa niżej wskazanych produktów z podziałem na poszczególne części: Zadanie nr 1 – wyposażenie pracowni biologicznej – modele Zadanie nr 2 – wyposażenie pracowni fizycznej – sprzęt do doświadczeń, eksperymentów, obserwacji Zadanie nr 3 –...
Ozorków,
łódzkie
15-12-2017

Usługa doradczo-szkoleniowa

Przetarg publiczny. Źródło - strony WWW. "ORION EXHAUST PARTS" RAFAŁ MATUSIEWICZ.
W związku z realizacją projektu w ramach Programu Operacyjnego Inteligentny Rozwój poddziałanie 3.3.3 Go to Brand. Zamawiający zaprasza do składania ofert na następujące działania: 1. Usługi szkoleniowej w zakresie umiędzynarodowienia Wnioskodawcy na rynku rosyjskim. Szkolenie obejmować ma również...
Łódź,
łódzkie
15-12-2017

Przeprowadzenie szkolenia w postaci studiów podyplomowych dla nauczycieli w związku z realizacją...

Przetarg publiczny. Źródło - strony WWW. GMINA I MIASTO SZADEK.
Przeprowadzenia szkolenia w postaci studiów podyplomowych dla nauczycieli
Szadek (miasto),
łódzkie
14-12-2017

Kurs wychowacy kolonijnego, wychowawcy

Przetarg publiczny. Źródło - strony WWW. FUNDACJA ARKA.
Przeprowadzenie kursu wychowawcy dla uczestniczek projektu Odzyskane Potencjały. Ilość godziny kursu powinna zagwarantować przygotowanie uczestniczek do egzaminu, którym kurs powinien się zakończyć.
Łódź,
łódzkie
14-12-2017

Urządzenia chłodnicze amoniakalne.

Przetarg publiczny. Źródło - strony WWW. POLSKI OGRÓD SP. Z O.O..
Przedmiotem zamówienia jest dostawa zgodnie z przepisami obowiązującego prawa instalacji chłodniczej amoniakalnej zasilanej z obiegu (-10 ⁰C), moduł A, dla schładzania pomieszczenia pilotażowej linii do produkcji mieszanek owocowo-warzywnych dla Polski Ogród Sp. z o.o. zakład w Skierniewicach. ...
Warszawa,
łódzkie
14-12-2017

Wagi wielogłowicowe 2 szt.

Przetarg publiczny. Źródło - strony WWW. POLSKI OGRÓD SP. Z O.O..
Przedmiotem zamówienia jest dostawa dwóch wag wielogłowicowych szesnasto-szalkowych współpracujących z grawitacyjnymi pakowaczami i układami podwójnego zasilania w produkt do budowy pilotażowej linii produkcji mieszanek owocowo-warzywnych, dla Polski Ogród Sp. z o.o. zakład w Skierniewicach. ...
Warszawa,
łódzkie
14-12-2017

Zakup i dostawa pomocy dydaktycznych do realizacji zajęć edukacyjnych w ramach projektu pod nazwą...

Przetarg publiczny. Źródło - strony WWW. GMINA WIDAWA.
Przedmiotem zamówienia jest zakup i dostawa pomocy dydaktycznych do realizacji zajęć edukacyjnych w ramach projektu pod nazwą „Szkoła – kierunek na przyszłość” realizowanego przez Gminę Widawa współfinansowanego ze środków Europejskiego Funduszu Społecznego w ramach Regionalnego Programu...
Widawa,
łódzkie
14-12-2017

usługi w projekcie "Twoja droga do aktywności" - D.P.

Przetarg publiczny. Źródło - strony WWW. OŚRODEK AKTYWIZACJI ZAWODOWEJ I SZKOLEŃ SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ.
1. Przeprowadzenie diagnozy społeczno-zawodowej, indywidualnego poradnictwa psychologicznego oraz warsztatów reintegracji społeczno-zawodowej "Kuźnia optymizmu" dla uczestników projektu: „Twoja droga do aktywności” o nr RPLD.09.01.01-10-B019/17-00. 2. Okres realizacji Zamówienia:...
Łódź,
łódzkie
14-12-2017

usługi w projekcie "Twoja droga do aktywności" - D.Z.

Przetarg publiczny. Źródło - strony WWW. OŚRODEK AKTYWIZACJI ZAWODOWEJ I SZKOLEŃ SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ.
1. Przeprowadzenie diagnozy poprzez ocenę motywacji i predyspozycji zawodowych, pośrednictwa pracy oraz realizacja warsztatów reintegracji społeczno-zawodowej "Kuźnia optymizmu" dla 60 uczestników projektu (UP) „Twoja droga do aktywności” o nr RPLD.09.01.01-10-B019/17-00. 2. Okres realizacji...
Łódź,
łódzkie
14-12-2017

ZAPYTANIE OFERTOWE NR 41/2017 z dnia 06.12.2017 r. W SPRAWIE ZAMÓWIENIA NA Dostawę obrabiarek...

Przetarg publiczny. Źródło - strony WWW. WAGRAN SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ.
Specyfikacja techniczna: Przedmiotem zamówienia jest zakup 2 szt. obrabiarek pomocniczych typu Wiertarka kolumnowa z przekładnią i bezstopniową regulacją prędkości obrotowej wraz z dostawą, montażem i szkoleniem dla pracowników. Dane maszyny: Napięcie elektryczne: 400 V / 3 Ph ~50 Hz Moc silnika...
Łódź,
łódzkie
14-12-2017

Organizacja i przeprowadzenie szkoleń/kursów zawodowych wraz z egzaminami potwierdzającymi nabycie...

Przetarg publiczny. Źródło - strony WWW. INSTYTUT NAUK SPOŁECZNO-EKONOMICZNYCH SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ-SPÓŁKA KOMANDYTOWA.
Przedmiotem zamówienia jest usługa organizacji i przeprowadzenia szkoleń/kursów zawodowych wraz z egzaminami potwierdzającymi nabycie kwalifikacji zawodowych dla uczestników/-czek projektu „Od zwolnienia do zatrudnienia…”. Części przedmiotu zamówienia: a) szkolenie/kurs: ECDL PROFILE B2 (1 osoba);...
Łódź,
łódzkie
14-12-2017

Dostawa i montaż wyposażenia pracowni chemicznej dla Publicznego Gimnazjum nr 33 w Łodzi

Przetarg publiczny. Źródło - strony WWW. MIASTO ŁÓDŹ.
Szczegółowy opis przedmiotu zamówienia został zamieszczony w załącznikach do niniejszego ogłoszenia.
Łódź,
łódzkie
14-12-2017

ZAPYTANIE OFERTOWE NR 40/2017 z dnia 06.12.2017 r. W SPRAWIE ZAMÓWIENIA NA Dostawę uchwytów do...

Przetarg publiczny. Źródło - strony WWW. WAGRAN SPÓŁKA Z OGRANICZONĄ ODPOWIEDZIALNOŚCIĄ.
Przedmiotem zamówienia jest dostawa uchwytów do obrabiarek o następujących parametrach: 1. IMADŁO MASZYNOWE DWUDZIELNE - 1SZT. 2. ZESTAW 4 KĄTOWNIKÓW POWIERZCHNIOWYCH, PRZYKŁADNIOWYCH (ZAKRES 50 DO 200MM) – 1KOMPL. 3. SUWMIARKA KIESZONKOWA ZE ŚRUBĄ BLOKUJĄCĄ 200MM – 1SZT. 4. GŁĘBOKOŚCIOMIERZ 200MM...
Łódź,
łódzkie
14-12-2017

Opracowanie Indywidualnych Ścieżek Reintegracji i przeprowadzenie grupowego poradnictwa zawodowego

Przetarg publiczny. Źródło - strony WWW. ZWIĄZEK MŁODZIEŻY WIEJSKIEJ.
Przedmiotem zamówienia jest usługa doradztwa polegająca na łącznej realizacji : 1. Identyfikacji potrzeb oraz opracowania Indywidualnej Ścieżki Reintegracji (IŚR) dla 22 osób biernych zawodowo lub zarejestrowanych bezrobotnych, w tym minimum 11 osób niepełnosprawnych w stopniu znacznym/umiarkowanym...
Warszawa,
łódzkie
14-12-2017
Strona korzysta z plików cookies w celu realizacji usług i zgodnie z Polityką Plików Cookies. Zamknij